GET THE APP

"Analysis of the Associated Mutations of DJ-1 Gene to Parkinson’s Patients in Vietnam"
..

International Journal of Neurorehabilitation

ISSN: 2376-0281

Open Access

Research - (2020) Volume 7, Issue 6

"Analysis of the Associated Mutations of DJ-1 Gene to Parkinson’s Patients in Vietnam"

Nguyen Minh Duc1, Nguyen Duc Hieu1, Ho Truong Giang2, Le Vo Hoang Long2, Nghiem Ngoc Minh1 and Vo Thi Bich Thuy1*
*Correspondence: Vo Thi Bich Thuy, Institute of Genome Research, Vietnam Academy of Science and Technology, Hoang Quoc Viet, Cau Giay, Hanoi 100000, Viet Nam, Tel: + 84964520846, Email:
1Institute of Genome Research, Vietnam Academy of Science and Technology, Hoang Quoc Viet, Cau Giay, Hanoi, Viet Nam
2Military Medical University, Phung Hung, Ha Dong, Hanoi, Viet Nam

Received: 31-Aug-2020 Published: 23-Sep-2020 , DOI: 10.37421/2376-0281.2020.7.377
Citation: Duc NM, Hieu ND, Giang HT, and Hoang Long LV, et al. "Analysis of the Associated Mutations of DJ-1 Gene to Parkinson’s Patients in Vietnam". Int J Neurorehabilitation Eng 7 (2020) doi: 10.37421/ijn.2020.7.377
Copyright: © 2020 Duc NM, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Abstract

The exact causes of Parkinson's disease (PD) are currently unknown, but studies have shown that the environment and genetics are the two factors that play the biggest role in Parkinson's disease. DJ-1 gene (belong to the PARK genes) is known as the main cause of Parkinson's disease in populations. In Vietnam, the evaluation of DJ-1 gene mutation frequency in patients is necessary to clarify the pathogenesis and genetic mechanisms of this disease. In this research, we identified the frequency mutations of the DJ-1 gene in Vietnamese PD patients. The results showed that we detected some DJ-1 mutations at exon 5 and exon 7. Interestingly, Ala86Gly and Gln95Leu mutations of exon 5 and His138Pro of exon 7 are found, which leads to a change in amino acid sequence and possibly a change in a functional protein. In addition, out of more than 20 heterozygous or homozygous mutations occurring in the intron regions 4 and 5, we found that 3 homozygous mutations occurred frequently in both patient and control. The data of mutation analysis has shown the ambiguous and unforeseeable meanings; however, they possibly associated with the mutation of PD. Therefore, the study of our next will focus on the relationship between these mutations with some clinical symptoms in patients.

Keywords

Difficulty map • DJ-1 gene • PARK7 loci • Vietnamese parkinson’s disease • Sequencin

Introduction

Parkinson's disease is a degenerative disorder of the central nervous system that affects a patient's movement, balance, and muscle control such as sluggish movement, and the appearance of advanced cognitive dysfunction and subtle language problems may occur [1]. Today, after Alzheimer's disease, PD is the second most common neurodegenerative disorder in the world [2]. The incidence of this disease depends on old age such as PD affects 1-2% of the population over the age of 60, but this rate increases to 4-5% at 85 years of age [3]. In Vietnam, the incidence of PD compared to other neurological diseases is about 1.6%.

The causes of PD are currently unknown, but researchers believe that the environment and genetics are the two factors that play the biggest role in PD. To date, scientists have found a link between genetic modification and a small percentage of Parkinson's onset patients under the age of 50. However, the role of genes is less commonly found in cases of late-onset disease. Genetics, in particular, mutant genes play a more important role in the early onset of Parkinson's disease [4]. At least 13 loci and 9 genes studied have been linked to PD, but only 6 genes have been found to be associated with Mendelian genetics [5]. Recent studies have focused on the transformation of these six genes, the functions of the proteins that encoded by them, the mutated proteins, and the pathways they are involved in. The genes related to PD are present inside the brain including the genes PARK1, PARK2, PINK1, LRRK2, PARK - 6 located on chromosome 1, and the Cytochrome P450 gene (CYP2D6) [6].

In the DJ-1 gene, mutations directly associated with PD mainly rare mutations only <1% of cases have an early onset [4]. With eight exons, exon 1 and exon 8 are non-coding and spliced, from exon 2 to 7 encoding for a protein 189 amino acid, which are highly conservation and expression. It was originally described as a carcinogen (oncogene), and later involved in male fertility [7,8]. The distribution of DJ-1 is naturally in the nucleus or cytoplasm, while the mutant DJ-1 shows a decrease in the nucleus position and move to the mitochondrial position [9]. DJ-1 has been shown to act as a redox-sensitive chaperone, preventing the association of synuclein and the NFL neuron subunit [10]. Furthermore, studies have demonstrated that in knocked-out DJ- 1, cells are often sensitive to oxidative stress for H2O2 production [11,12].

Methods

Patient selection

Blood samples of thirty-two Parkinson patients were collected from Vietnam hospital (Table 1). The standard neurological clinical test was carried out before this study. The diagnosis based on published document [13,14]. The Medical Ethics Committee of the Institute of Genome Research (Vietnam) approved this research. All of Parkinson's patients already provided related documents.

Information Parkinson patients
Age in research time, 66.4±6.3
Age of male patients 63.9±7.11
The number of male patients 24 (75%)
Age of female patients 63.5±7.45
The number of male patients 8 (25%)

Table 1: The general information of Parkinson’s disease patients (n=32).

Genomic DNA analysis

The blood samples were collected from peripheral vein patients by using venipuncture. The DNA purification kit of Thermo Science (USA) was used for extracting genomic. Polymerase chain reaction (PCR) was carried out using Taq DNA polymerase and the following primer sequences (Table 2), with conditions: 35 cycles were run at 95°C for 45 s, 63°C for 40 s and 72°C for 1 min followed by 7 min terminal elongation at 72°C. The PCR products were 392 bp (exon 2), 388 bp (exon 3), 297 bp (exon 4), 258 bp (exon 5), 297 bp (exon 6) and 378 bp (exon 7) of the DJ-1 gene. PCR was carried out in a final volume of 50μl including 2.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphate, 0.5 μM forward and reverse primers, 1 U Taq polymerase (Promega- M8305, USA), and 10 ng of DNA. The quality of the PCR products was analyzed by electrophoresis agarose gel with the design size.

Primer Sequences (5’ – 3’) Exon Reference
E2-F CTCTGCTTGAAAATGCTCC Exon 2 (392bp) [14]
E2-R GGCAAGACATTAACAAGCG
E3-F TTAAAGACAGTGTTACTCTGAATT Exon 3 (388bp) [14]
E3-R CATCCAGCCACCCACTTAC
E4-F GGCTATCTCCTGTACTTCCC Exon 4 (297bp) [14]
E4-R TCACAGCCTCCTCCCGAA
E5-F AAATAGGTCAGAGAGCTTGTGG Exon 5 (258bp) [14]
E5-R TCAAACCATCGAATGAAAGG
E6-F CTCAAGCAATTTTTCTACCT Exon 6 (297bp) [14]
E6-R GAGGCTGAGAGAGAAGAATCG
E7-F ACAGTGTTGGGTTTATATGCTG Exon 7 (378bp) [14]
E7-R GGACAGCGACTTCTGAACAC

Table 2: Primers used in the study.

Purification of the amplified fragment was performed by using GeneJET PCR purification kit (Thermo Science, USA). The isolated DNA fragments were sequenced according to the manufacturers’ instructions. The ABI 3500 Genetic Analyzer machine was used to read electrophoreses products.

Bioinformatic analysis

We used a sequence of DJ-1 genes on Genebank (with code NC_000001.11) as a reference sequence. The Ensemble database software supported all of the exon and protein sequences. These sequences used to determine the location of 6 exons in our research. Multiple sequence alignments were performed by Clustal-W tools, and this result was used to determine the nucleotide and amino acid mutation. The BioEdit bioinformatics tool was used for the nucleic acid sequences of two groups (patient and control) to translate and get protein sequences.

Conclusions

Although we identified several alterations in the DJ-1 gene, the present study is the first to evaluate the mutation frequency of this gene in Vietnamese Parkinson patients. To clearly understand the pathogenic associations of the patient with the DJ-1 gene, the advanced studies focusing on large genetic cohort and epigenetic inactivation mechanisms involving these genes are required in PD patients and in their relatives with suspected symptoms. The data obtained in the present study might be useful in clinical genome wide association studies.

References

Google Scholar citation report
Citations: 1078

International Journal of Neurorehabilitation received 1078 citations as per Google Scholar report

International Journal of Neurorehabilitation peer review process verified at publons

Indexed In

 
arrow_upward arrow_upward