GET THE APP

Detection and drug targeting of both PSMA (+) and PSMA (-) prostate cancer cells using a RNA/peptide dual-aptamer conjugate
..

Biosensors & Bioelectronics

ISSN: 2155-6210

Open Access

Detection and drug targeting of both PSMA (+) and PSMA (-) prostate cancer cells using a RNA/peptide dual-aptamer conjugate


International Conference and Exhibition on Biosensors & Bioelectronics

May 14-16, 2012 Embassy Suites Las Vegas, USA

Changill Ban, Hunho Jo and Kyoungin Min

Posters: J Biosens Bioelectron

Abstract :

Prostate cancer is the second most common cancer in men, and for this reason, its early diagnosis and proper treatment have been a matter of great concern. Prostate cancer has two types of cell lines based on the expression of the PSMA (prostate specific membrane antigen): PSMA (+) and PSMA (-) cell lines. Researches on PSMA (+) prostate cancer have been highly reported for its importance in diagnosis and drug targeting; however, treatments for PSMA (-) cell lines have been scarcely investigated compared to that of PSMA (+) cells. Furthermore, the simultaneous detection of both cell types has not been reported yet. Based on this need to develop new techniques for types of prostate cancer involving the PSMA (-) cell line, we constructed a simple and direct impedance sensor to detect prostate cancer cells using its specific two aptamers; an anti-PSMA RNA aptamer4 (A10,GG GAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC, underlined nucleotide represents the modified pyrimidins of 2?-F UTP and 2?-F CTP) for PSMA (+) cell line and a DUP-1 peptide aptamer5 (FRPNRAQDYNTN) for PSMA (-) cell line. And also differential pulse voltammetry (DPV) method was used to confirm the effect of an anticancer drug, especially doxorubicin, which would be selectively delivered to prostate cancer cells using these aptamers.

Biography :

Ban has completed his Ph.D from the Ohio State University and postdoctoral studies from NIH. He has published more than 50 papers in reputed journals and serving as an editorial board members of Sensors and Journal of Korean Chemical Society.

Google Scholar citation report
Citations: 6207

Biosensors & Bioelectronics received 6207 citations as per Google Scholar report

Biosensors & Bioelectronics peer review process verified at publons

Indexed In

 
arrow_upward arrow_upward